Page 88 - scheppingen

four
86
ng/ml; Sigma, St. Louis, USA) for 24 hours. Treatment of FCD-derived astrocytes with rapamycin (100 nM) was started 24 hours before, and continued during IL-1β stimula- tion. Cells were harvested 24 hours after stimulation. Viability of human cell cultures was not influenced by the performed treatments (supplementary Fig. 2).
For immunofluorescent staining of cell cultures, sections were incubated with the primary antibodies for β1, β1i, β5 or β5i for 1 hour at RT, followed by 2 hour incubation at RT with Alexa Fluor® 568-conjugated anti-rabbit or Alexa Fluor® 488-conjugated anti- mouse IgG (1:200, Molecular Probes, The Netherlands) together with Alexa Fluor® 488 or 594 Phalloidin (1:200, Molecular Probes, The Netherlands) for counterstaining actin filaments. Sections were mounted using Vectashield with DAPI (Vector Laboratories Inc., Burlingame, CA, USA) . Fluorescent microscopy was performed using Leica Confocal Microscope TSC SP-8X (Leica, Son, the Netherlands) at 40x magnification (bidirectional X, speed: 600 Hz, pinhole: 1.00 AU).
RNA isolation and real-time quantitative PCR analysis
For RNA isolation, cell culture material was homogenized in Qiazol Lysis Reagent (Qiagen Benelux, Venlo, The Netherlands). Total RNA was isolated using the miRNeasy Mini kit (Qiagen Benelux, Venlo, The Netherlands) according to manufacturer’s instructions. The concentration and purity of RNA were determined at 260/280 nm using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). To evaluate β1, β1i, β5 or β5i, and IFN-γ mRNA expression, 200 ng of cell culture-derived total RNA was reverse-transcribed into cDNA using oligo dt primers. PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland) using the following primers: β1 (forward accagctcggtttccaca: reverse: cccggtatcggtaacacatc); β5 (forward: gagtctcagtgatggtctgagc, reverse: actccatggcggaacttg); β1i (forward: accaaccg- gggacttacc, reverse: tcaaacactcggttcaccac); β5i (forward: ccctacccacccctgttt; reverse: cacccagggactggaaga); IFN-γ (forward: gcaagatcccatgggttgtgt; reverse: ctggctcagattgcag- gcata). Quantification of data was performed using the computer program LinRegPCR in which linear regression on the Log (fluorescence) per cycle number data is applied to determine the amplification efficiency per sample 31, 32. The starting concentration of each specific product was divided by the geometric mean of the starting concentration of the reference genes (EF1α and C1orf43) and this ratio was compared between groups.
Statistical analysis
Statistical analyses were performed with GraphPad Prism software (Graphpad software Inc., La Jolla, CA, USA). To assess differences in immunoreactivity score between multi- ple groups, non-parametric Kruskal-Wallis followed with Mann-Whitney U test was used. Correlations were assessed using Spearman’s (rho) rank correlation test. For cell culture data, Mann-Whitney U test was used to asses differences between different conditions. P<0.05 was assumed to indicate a significant difference.
Results
Case material and histological features
The clinical features of the cases included in this study are summarized in Table 1. All operated patients had a history of chronic pharmacoresistant epilepsy. In this study we