Page 94 - Physico-Chemical Niche Conditions for Bone Cells

PFF affects pre-osteoblast behavior
was eluted from the samples using 0.2 M NaOH/methanol (1:1, v/v) for 30 min under shaking. Hundred μl of this solution per well of a 96-well plate (Greiner Bio-One, Alphen a/d Rijn, The Netherlands) was used to measure the absorbance at 550 nm with a microplate reader (BioRadLaboratories Inc., Veenendaal, The Netherlands). A mixed NaOH and methanol solution was used as blank. Three independent experiments with 24 glass slides (n=3) were performed.
ECM mineralization and quantification
Mineralization of the ECM produced by MC3T3-E1 pre-osteoblasts attached to glass slides was analyzed after 28 days of culture in osteogenic induction medium, following 1 h PFF or static control treatment. To determine mineralization, cells were washed with PBS, and fixed in 4% paraformaldehyde for 15 min at 37°C. Fixed cells were incubated with 40 mM Alizarin Red staining solution (Merck, Darmstadt, Germany), pH 4.3, at room temperature for 30 min, and washed extensively with deionized water to remove unreacted dye. Optical images were taken using a stereo microscope. For semiquantitative mineralization analysis, the red-stained mineralized nodules were dissolved with 10% cetylpyridinium chloride (Sigma, Los Angeles, CA, USA) in 10 mM sodium phosphate (Sigma) to measure the optical density at 620 nm. A mixed cetylpyridinium chloride and sodium phosphate solution was used as blank. Three independent experiments with 24 glass slides (n=3) were performed.
Analysis of gene expression
Total RNA was isolated using TRIzol ® reagent (Life Technologies, Waltham, MA, USA), and stored at -80°C prior to further use. Complementary DNA (cDNA) synthesis was performed according to the First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Vilnius, Lithuania) in a thermocycler GeneAmp® System 9700 PE (Applied Biosystems, Foster City, CA, USA). cDNA was stored at -20°C prior to RT-PCR analysis, and diluted 5x for gene expression analysis. RT-PCR reactions were performed using 1 μl cDNA per reaction and LightCycler® 480 SYBR® Green I Mastermix (Roche Diagnostics, Mannheim, Germany) in a LightCycler® 480 (Roche Diagnostics). RT-PCR conditions for all genes were as follows: 10 min pre- incubation at 95°C, followed by 45 cycles of amplification at 95°C for 10 s, 56°C for 5 s, 72°C for 10 s, and 78°C for 5 s, after which melting curve analysis was performed. With LightCycler® software (version 1.2), crossing points were assessed and plotted versus the serial dilution of known concentrations of the internal standard. For gene expression analysis, the values of target gene expression were normalized using Pbgd (Forward primer sequence (5’-3’) (Forward): AGTGATGAAAGATGGGCAACT; Reverse primer sequence (5’-3’) (Reverse): TCTGGACCATCTTCTTGCTGA) to obtain relative gene expression. RT-PCR was used to assess expression of the following genes: proliferation marker Ki-67 (Forward:
92