Page 138 - Assessing right ventricular function and the pulmonary circulation in pulmonary hypertension Onno Anthonius Spruijt
P. 138
8
score was calculated on a minimum of 20 randomly selected 40X high‐power fields per slide and Ki‐ 67 positive cells around the vessels (<100μm) were counted (approximately 40‐50 vessels per slide). Number of Ki‐67 positive cells per vessels was calculated for comparison between groups. CD68‐ positive cells were counted in whole‐lung tissue sections and expressed as per mm2.
Western Blotting
Rat lung samples were homogenized in RIPA buffer (150 mmol/L sodium chloride, 1.0% NP‐40 or Triton X‐100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mmol/L Tris, pH 8.0, supplemented with protease inhibitor; Roche). Western blotting was performed according to the manufacturer’s suggestions (rabbit polyclonal anti‐TK1 and anti‐ENT1 1:1000; Abcam). Proteins were detected by Novex ECL chemiluminescence (Invitrogen). Optical densities of individual bands were measured, and protein expression was standardized with GAPDH.
Cell Culture
Pulmonary artery adventitial fibroblasts isolated from the lungs of IPAH patients and healthy donors were obtained from the University of Giessen and Marburg Lung centre tissue bank. Our previous experiment have shown that the IPAH pulmonary arterial fibroblasts exhibited greater proliferation capacity 9. We extracted RNA by the Trizol method from pulmonary artery adventitial fibroblasts and donor cells cultured in 6‐well plates. Total RNA was transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), followed by real‐time polymerase chain reaction analysis of ENT1 and thymidine metabolism enzyme genes (TK1 and thymidine phosphorylase TP) using primers described in Table 2.
Name
TK 1
ENT1
TP
Table 2. Real‐Time Polymerase Chain Reaction Primers for the Thymidine Kinase 1 (TK1), Equilibrative Nucleotide Transporter 1 (ENT1) and Thymidine Phosphorylase (TP).
Statistical Analysis
Data are presented as mean±SEM. Normal distribution was verified with the Kolmogorov‐Smirnov test, and variance of homogeneity was tested by the Levene test. Differences between groups were
Forward Primer
Reverse Primer
CCGTGGTTTAAAGCGGTCG ACTCCAAAGTCTCAGCAGCAGG AGGAGGCACCTTGGATAAGC
GGACGCGTCTCATCAACTCT AGAGTTCCGCTCAGGCAAG GCCCCTCCACGAGTTTCTTA