Page 149 - Cellular Imaging in Regenerative Medicine, Cancer and Osteoarthritis
P. 149

                                SPECT imaging of pro-inflammatory macrophages
USA) in X-VIVOTM 15 medium (Lonza, Verviers, Belgium) supplemented with 20% heat-inactivated fetal calf serum (FCS; Lonza, Verviers, Belgium), 50 μg/ mL gentamicin (Gibco, Carlsbad, USA) and 1.5 μg/mL amphotericin B (Gibco, Carlsbad, USA), from now on referred to as M(IFNγ+TNFα). The macrophages were stimulated 3 days at 37°C and 5% CO2. Media and stimuli were refreshed 24h prior to harvest.
To determine the expression of SSTR2 in human synovial tissue, synovium was obtained as waste material from OA patients (n=4, 60±13Y) undergoing total knee replacement surgery. Fat tissue was macroscopically removed and the synovium was cut into pieces of approximately 40 mg wet weight and cultured in Dulbecco’s Modified Eagle Medium, low glucose (DMEM; Gibco, Carlsbad, USA), supplemented with 1% Insulin-Transferrin-Selenium (ITS+ Premix, Corning, New York, USA), 50 μg/mL gentamicin (Gibco, Carlsbad, USA), 1.5 μg/mL amphotericin B (Fungizone; Gibco, Carlsbad, USA) and 25 μg/mL L-ascorbic acid 2-phosphate (Sigma-Aldrich, St. Louis, USA). To simulate acute inflammation, half of the number of the explants was stimulated with 10 ng/ mL IFNγ + 10 ng/mL TNFα. After 24h of stimulation, the synovial explants were harvested and stored at -80°C until gene expression analysis.
Messenger RNA (mRNA) was isolated from the macrophages using the RNeasy Micro Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. For the synovial explants, the tissue was first frozen in liquid nitrogen followed by pulverization using a Mikro-Dismembrator (B. Braun Biotech International GmbH, Melsungen, Germany) at 3000 rpm. The tissue was then homogenized with Trizol (Gibco, Carlsbad, USA) and 20% chloroform (Sigma-Aldrich, St. Louis, USA). Complementary DNA (cDNA) was synthesized using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas GmbH, Leon-Rot, Germany) according to manufacturer’s instructions. Expression of SSTR2 was evaluated using a TaqMan SSTR2 Gene Expression Assay (Hs00990356_m1; Thermo Fisher Scientific). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Fw: CAACGGATTTGGTCGTATTGGG; Rev: TGCCATGGGTGGAATCATATTGG; Probe: GGCGCCCCAACCAGCC) was used as a housekeeping gene.
147
7
 




























































































   147   148   149   150   151