Page 300 - Personalised medicine of fluoropyrimidines using DPYD pharmacogenetics Carin Lunenburg

Chapter 11
droplets only emit one fluorescent label, red or blue, when the DNA strands are being amplified. All droplets are read out one by one (C) and in cis or in trans phasing can be determined (D). ddPCR can be used for DNA samples and detect phasing of variants in up to 200 kb. For DPYD, combinations of DPYD*2A+DPYD*13 (66 kb distance) and DPYD*2A+c.1236G>A (124 kb distance) can be determined using ddPCR.
PacBio: Pacific Biosciences RSII (PacBio)4 starts with RNA isolation from PAXgene tubes using RNeasy® Mini Kit (Qiagen, Hilden Germany) according to manufacturer’s protocol. Then, cDNA is synthesized using SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad CA USA) using oligo-dT or DPYD gene specific reverse primers (F2: GTTTGCCAGAACCCAATAAAGA, F3: CGTCATTGTACTTGGAGCTGG, Rev: CCACAAAACCTGTATTACTGAATAA, Rev-comp: TTATTCAGTAATCAGGTTTTGTGG). cDNA is amplified using KAPA HiFi HotStart ReadyMixPCR Kit (Kapabiosystems, Wilmington MS USA). Amplicon preparation is executed according to PacBio® Procedure and Checklist - Amplicon Template Preparation and Sequencing. PacBio is based on single molecule real-time (SMRT) sequencing. On each of the four nucleotides different fluorophore labels are attached (A), which will emit when the nucleotide is build-in, which is shown as a fluorescence pulse or color peak (B). When a patient carries multiple variants, multiple fluorescent labels will be emitted at the same time, resulting in two color peaks simultaneously (C). Variants can either be located on the same strand (in cis) or on different strands (in trans), determined by reading the strands (D). The advantage of SMRT-sequencing is that longer read lengths of DNA or RNA are possible, therefore phasing of variants in the large DPYD gene can be determined.
Plasmid: cloning as described previously.5 First, patient RNA was isolated using RNeasy® Mini Kit (Qiagen, Hilden Germany). With 500 ng RNA, cDNA was synthesized using 10 mol/μl oligodT primer in a 10.25 μl volume which was incubated for 10 minutes at 70 degrees Celsius. After cooling, 2 μl 0.1M DTT, 2 μl dNTPs (5 mM), 4 μl first strand buffer, 0.5 μl reverse transcriptase (RT), and 0.25 μl RNasin® (Invitrogen, Bleiswijk the Netherlands) was added and incubated for 1 hour at 37 degrees Celsius. Thereafter, a PCR was performed using Qiagens universal mastermix and primers approximately 500 nucleotides up or downstream of the variants (DPYD*2A: ACCACCTCTGGCCCCATG, c1236G>A: GGTGGGAGAATTGTTGCTATG and c.2846A>T: GTAGCCAGAATCATTACAGG). Plasmids were created by ligation of the specific PCR products into pGEM-T Easy vector (A) (Promega, Leiden Netherlands) as follows: 0.5 μl pGEM-T Easy, 0.5 μl Ligase, 3 μl PCR product and 4 μl buffer was incubated for 2 hours at room temperature. Ligation mixture was transformed to competent E coli cells (JM109) (B) and plated on IPTG/Xgal (Promega, Leiden Netherlands) containing LB-ampicillin agar plates (Acumedia Neogen, Ayrshire UK). Plates were incubated overnight at 37 degrees Celsius. Next day, cells with successful insertions (resulting in white colonies) are grafted in 2 ml LB-ampicillin and shaken overnight at 37 degrees Celsius. Plasmid DNA was isolated using Miniprep Kit (Qiagen, Hilden Germany) and restriction enzyme EcoR1 as used to check for insertion of PCR product (approximately 1000 bp insert). Thereafter, sequencing was performed by Macrogen (Amsterdam, the Netherlands) using primers T7 (GTAATACGACTCACTATAGGGC) and SP6 (ATTTAGGTGACACTATAGAA) located on both sides of A-T ligation side (C). Plasmids contain only one allele of the PCR product, thus combined sequence result of T7 and SP6 primers determines the haplotype. Thus, when only one variant was found, the unidentified variant is located on the other allele, and therefore phasing results are in trans. When both variants, or no variants were found, phasing results are in cis (D).
298